| Primary Identifier | MGI:5688853 | Allele Type | Endonuclease-mediated |
| Attribute String | Hypomorph | Gene | Sprr1a |
| Strain of Origin | C57BL/6NJ | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project Sprr1a-7038J-M1170 was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences, TCGGGAACAACAGGGTGGCA, and GGGTTGCAGGGCTCAGGAAC, which resulted in a 237 bp deletion beginning in exon 2 at Chromosome 3 negative strand position 92,484,565 bp, CTGTTCCTGAGCCCTGCAAC, and ending after GGCGCCTGAGCCCTGCCACC at 92,484,329 bp (GRCm38/mm10) in exon 2. This mutation results in the deletion in exon 2 of 237 bp and results in an amino acid change after 44 residues and early truncation 21 amino acids later. |
