|  Help  |  About  |  Contact Us

Allele : Arr3<em1(IMPC)J> arrestin 3, retinal; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5688598 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Arr3
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Arr3-7032J-M2356 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences, ATCCTCATTGCCCTTCCATT, CCATTCTTCAGCATCTCGGT, ATTGGCCTCATAGCTCTGCA, and AGGCCAATTGAAAGGTAGAA, which resulted in a 313 bp deletion beginning in intron 4 at Chromosome X positive strand position 100,606,939 bp at GAATGGAAGGGCAATGAGGATG and ending after GAAAGGAAAGAATCCTTTCAG at 100,607,251 bp (GRCm38/mm10) in intron 5. This mutation results in the deletion of exon4 and is predicted to cause a change in amino acid sequence after residue 13 and early truncation 10 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Arr3<em1J>,
  • Arr3<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele