|  Help  |  About  |  Contact Us

Allele : E130311K13Rik<em1(IMPC)J> RIKEN cDNA E130311K13 gene; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5689821 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  E130311K13Rik
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project E130311K13RIK-7012J-M2RMP1 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, AACAACTGTAGTGATTGTTA, AGAAAGAAAGTTAAACTACG, and TGTCTTCTTGTTAAATGCTT, which resulted in a 139 bp deletion beginning in intron 3 at Chromosome 3 negative strand position 63,925,555 bp, TAAATGCTTAGGTATCTTCACAT, and ending after AAGAAAGAAAGTTAAACTACG at 63,925,417bp(GRCm38/mm10) in exon 3. This mutation deletes the splice acceptor as well as 64bp from exon 3 essentially removing the entire exon. This mutation is predicted to result in amino acid sequence change after 58 residues and early truncation 13 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • E130311K13Rik<em1J>,
  • E130311K13Rik<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele