| Primary Identifier | MGI:5689890 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Sebox |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Sebox-7066J-M4984 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, ATCAAGGCTTTGGGGCTGGG, CAACTGCCCGACACTGAAAG, TCTGTCCCACAAGGCTGTGC, which resulted in a 304 bp deletion beginning in intron 2 at Chromosome 11 positive strand position 78,503,682bp, GGGCTGGGTGGAGGCTCTTGC, and ending after TTTCTGTCCCACAAGGCTGTG at 78,503,985bp(GRCm38/mm10) in intron 3. The 304 bp mutation deletes all of exon 2 and is predicted to cause a change in amino acid sequence after amino acid residue 10 and early truncation 80 amino acids later. |
