|  Help  |  About  |  Contact Us

Allele : Zfp579<em1(IMPC)J> zinc finger protein 579; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5696236 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Zfp579
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Zfp579-7041J-M1234 was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences, CGGAAAGCTTTGGGGCACAG and CCAAGAGCACGCAGGTAGCG, which resulted in a 1 bp T insertion in exon 1 beginning at Chromosome 7 positive strand position 49,94,713bp (GRCm38/mm10). This mutation results in a change of amino acid sequence after amino acid residue 78 and early truncation 49 amino acid residues later. In addition, 141 bases after the T insertion there is an 8 bp deletion GTAGCGAG, which does not appear to affect the result of the insertion.
  • mutations:
  • Intragenic deletion,
  • Insertion
  • synonyms:
  • Zfp579<em1J>,
  • Zfp579<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele