|  Help  |  About  |  Contact Us

Allele : Kcnb2<em1(IMPC)J> potassium voltage gated channel, Shab-related subfamily, member 2; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5697048 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Kcnb2
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Kcnb2-6924J-M9857 was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence AGCTTCCCCAGGCGTGTCCG, with a non-contributing plasmid, which resulted in an 8 bp deletion (CCGGACAC) in exon1 beginning at Chromosome 1 positive strand position 15,312,622 bp (GRCm38/mm10). This mutation is predicted to cause amino acid sequence changes after residue 57 and early truncation 7 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Kcnb2<em1J>,
  • Kcnb2<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele