|  Help  |  About  |  Contact Us

Allele : Ndufs8<em1(IMPC)J> NADH:ubiquinone oxidoreductase core subunit S8; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5749812 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ndufs8
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Ndufs8-7413J-M338 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences, CTACCTTGATACACTCCCCC, TTTAGGGCCTAGTAGTTAGA, TCAGGCGTGGACGGCCGGAG and GAGAGTCAGGCGTGGACGGC, which resulted in a 282 bp deletion spanning exon 5 beginning at Chromosome 19 negative strand position 3,911,117 bp, CGGCCGGAGAGGAGAGCATCC, and ending after CCCTACCTTGATACACTCC at 3,910,836 bp (GRCm38/mm10). This mutation deletes exon 5 and 109 bp of intronic sequence including the splice acceptor and donor. It is predicted to result in a change in amino acid sequence after residue 69 and early truncation 3 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Ndufs8<->,
  • Ndufs8<->,
  • Ndufs8<em1J>,
  • Ndufs8<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

6 Publication categories

Trail: Allele