| Primary Identifier | MGI:5750696 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Mpv17 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Mpv17-7397J-F2271 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCCTAGGTAGGAAAGGCCAA, CGTTGGTTTCTGTTCCTGGA, GCTTGGCACTCCGAGTTCTA, and TCAGCAGATTTTCCTTTTAG, which resulted in a 212 bp deletion spanning exon 3 beginning at Chromosome 5 negative strand position 31,146,130 bp, CTTTTAGGGGATGTCCTGAC, and ending after TGGCTTTTCCATTGGCCTTTC at 31,145,919 bp (GRCm38/mm10). This mutation deletes exon 3 and 96 bp of intronic sequence including the splice acceptor and donor, and there is another small 22 bp deletion in the intron that will not affect the exon deletion. This mutation is predicted to cause an amino acid change after 24 residues and early truncation 65 amino acids later. |
