| Primary Identifier | MGI:5752781 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Neil2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Neil2-7414J-M375 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCCATGCCTTGCCACAGAGG, GACATGTGCAGGGGTCCTAG, GACCCTAAGAGACCTTCACA, and GCCCCTGTGAAGGTCTCTTA, which resulted in a 589 bp deletion spanning exon 3 beginning at Chromosome 14 negative strand position 63,188,250 bp, TGAAGGTCTCTTAGGGTCAA and ending after GCTTAGGTCCTGGAGAGGAG at 63,188,250 bp (GRCm38/mm10). This mutation deletes exon 3 and 248 bp of flanking intronic sequence including the splice acceptor and donor. This deletion is predicted to cause a change in amino acid sequence after residue 46 and early truncation 5 amino acids later. |
