|  Help  |  About  |  Contact Us

Allele : Fam170a<em1(IMPC)Tcp> family with sequence similarity 170, member A; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:5754599 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Fam170a
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele, from project TCPR0407, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences GAGTGTGGAGTGCGATAGTG, TGTCACACTAATGTCACTCG, GAGGTGCAAGCCTACCCTAG and TCCGAACTTCCTGCGGGAGC. This resulted in a 1,167 bp deletion from Chr18:50281278 to 50282444, encompassing ENSMUSE00000373759. (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele