| Primary Identifier | MGI:5754996 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Nhs |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele produced from project TCPR0257 at TCP by injecting Cas9 mRNA and two guide RNAs with the spacer sequences ACATCTTCCTCCCAGCGACC and CTTGCTCTCGATGTCCAAGT. This resulted in a 77 bp deletion from ChrX:161875305 to 161875381 in ENSMUSE00000470130. This mutation is predicted to cause a frameshift with amino acid changes after residue 190 and early truncation 19 amino acids later (p.L190Qfs*21). (GRCm38). |
