|  Help  |  About  |  Contact Us

Allele : Gpr141b<em1(IMPC)Tcp> G protein-coupled receptor 141B; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:5754575 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Gpr141b
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0383 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and three guide RNAs with the spacer sequences CACTTGAGCCATTTGACACG, GTTACAAAAGTTCCATGCCG and TTATACCCCACCATGCATTC. This resulted in a 737-bp deletion in Chr13:19729115 to 19729852 (ENSMUSE00000732266; GRCm38). This mutation is predicted to cause a frameshift with amino acid changes after residue 10 and early truncation 41 amino acids later (p.S10Ffs*43).
  • mutations:
  • Intragenic deletion,
  • Insertion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele