|  Help  |  About  |  Contact Us

Allele : Baz2a<em1(IMPC)Tcp> bromodomain adjacent to zinc finger domain, 2A; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:5754585 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Baz2a
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0415 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and single guide RNAs with spacer sequences of AGCACACAAGCTTGATAAAC and GTGTAGGACTGTCTGCATGC targeting the 5' side and GTTCTACTCATGCCTTCCAA and ATAGTAATGGCCAAACGAGA targeting the 3' side of exons 9-11 (ENSMUSE00000272786, ENSMUSE00000272778, and ENSMUSE00000471272) resulting in a 1,067-bp deletion in Chr10:128115947 to 128117012, and insAAGCA (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele