| Primary Identifier | MGI:5755044 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Pstpip2 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele, from project TCPR0319, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences TCCACATTTTGCTCGGCTCA, CTGCGTTTTACCTTCCCCAA, GTACAGATTCATGGGCCCAC, and GCAGGCGGGTGTGAAGCATC. This resulted in a 686 bp deletion from Chr18:77847879 to 77848564 encompassing ENSMUSE00000514786. (GRCm38). |
