| Primary Identifier | MGI:5755383 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Dalrd3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Dalrd3-7439J-M5809 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTAGTTCCGTGGATCCCGCT, GTAAGTGGGCCGTAGTTCCG, GAGTCATGATAATCTAAGCC, and GTGCGTGTTCGAAGCTATAA, which resulted in a 413 bp deletion spanning ENSMUSE00000221392 (exon 2) beginning at Chromosome 9 negative strand position 108,570,528 bp, CAGGCTTAGATTATCATGAC, and ending after GTGTAAGTGGGCCGTAGTTC at 108,570,116 bp (GRCm38/mm10). This mutation deletes exon 2 and 117 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change in amino acid sequence after residue 55 and early truncation 45 amino acids later. |