|  Help  |  About  |  Contact Us

Allele : Dalrd3<em1(IMPC)J> DALR anticodon binding domain containing 3; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5755383 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Dalrd3
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Dalrd3-7439J-M5809 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTAGTTCCGTGGATCCCGCT, GTAAGTGGGCCGTAGTTCCG, GAGTCATGATAATCTAAGCC, and GTGCGTGTTCGAAGCTATAA, which resulted in a 413 bp deletion spanning ENSMUSE00000221392 (exon 2) beginning at Chromosome 9 negative strand position 108,570,528 bp, CAGGCTTAGATTATCATGAC, and ending after GTGTAAGTGGGCCGTAGTTC at 108,570,116 bp (GRCm38/mm10). This mutation deletes exon 2 and 117 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change in amino acid sequence after residue 55 and early truncation 45 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Dalrd3<em1J>,
  • Dalrd3<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele