| Primary Identifier | MGI:5755394 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Pdgfrl |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Pdgfrl-7448J-M4575 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGTAAGGAACCCACAGCAGG, ACTTATGATTATGGCTGAAA, GTTAATACCGCATCTCCCAA, and CTTGGCCTAGCACAATAAAC, which resulted in a 395 bp deletion spanning exon 2 beginning at Chromosome 8 positive strand position 40,938,018 bp, TTGAAGCCACCTGCTGTGGG and ending after GCATCACTGGCTTCCTGTTTA at 40,938,412 bp (GRCm38/mm10). This mutation deletes exon 2 and 97 bp of flanking intronic sequence including the splice acceptor and donor. There is a small 7bp (GTGGCAT) insertion and coincident deletion of 3 base pairs (AAA)in the intron before the deletion, and an additional 12 bp deletion downstream of the 395 bp exon 2 deletion in the intron, that does not affect the deletion of the exon. This mutation is predicted to result in an early truncation after 19 amino acids. |