|  Help  |  About  |  Contact Us

Allele : Pdgfrl<em1(IMPC)J> platelet-derived growth factor receptor-like; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5755394 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Pdgfrl
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Pdgfrl-7448J-M4575 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGTAAGGAACCCACAGCAGG, ACTTATGATTATGGCTGAAA, GTTAATACCGCATCTCCCAA, and CTTGGCCTAGCACAATAAAC, which resulted in a 395 bp deletion spanning exon 2 beginning at Chromosome 8 positive strand position 40,938,018 bp, TTGAAGCCACCTGCTGTGGG and ending after GCATCACTGGCTTCCTGTTTA at 40,938,412 bp (GRCm38/mm10). This mutation deletes exon 2 and 97 bp of flanking intronic sequence including the splice acceptor and donor. There is a small 7bp (GTGGCAT) insertion and coincident deletion of 3 base pairs (AAA)in the intron before the deletion, and an additional 12 bp deletion downstream of the 395 bp exon 2 deletion in the intron, that does not affect the deletion of the exon. This mutation is predicted to result in an early truncation after 19 amino acids.
  • mutations:
  • Intragenic deletion,
  • Insertion
  • synonyms:
  • Pdgfrl<em1J>,
  • Pdgfrl<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele