|  Help  |  About  |  Contact Us

Allele : Slc23a3<em1(IMPC)Tcp> solute carrier family 23 (nucleobase transporters), member 3; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:5755087 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Slc23a3
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele, from project TCPR0311, was generated at The Centre for Phenogenomics by injecting Cas9 nickase (D10A) mRNA and four guide RNAs with spacer sequences CAGCGAGACTGAATAAATTA, GTCACGTGGTATGATACCTC, GGACTGTCGGGAGTAATCAA, and GTTTAGATTATCAGGCCCTG. This resulted in a 1154 bp-deletion from Chr1:75131276 to 75132429 in OTTMUSE00000662432 & OTTMUSE00000662425 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele