| Primary Identifier | MGI:5763625 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tomm22 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Tomm22-7567J-M3164 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCTGGCCCTTCCGTGCCGCG, CGTGGACGCCGCGAGCCGAG, GTGGTTGGTCTTCTGCAGAA and CGGGTGCTGTCAAAGGACAG, which resulted in a 345 bp deletion spanning exon 2 beginning at Chromosome 15 positive strand position 79,671,092 bp, GCACGGAAGGGCCAGGCCCG, and ending after GAGTGTGGTTGGTCTTCTGC at 79,671,436 bp (GRCm38/mm10). This mutation deletes exon 2 and 225 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 39 and early truncation 22 amino acids later. |
