| Primary Identifier | MGI:5763011 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tgfbr3l |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Tgfbr3l-7560J-F9665 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTTGGCATGCGGCTGAGCAT, TAGGCCCTGATGCCACTAAG, GGCGCCTTAAACGACGAGGG and GCAGGATCAAGGCGCCATCA, which resulted in a 345 bp deletion spanning exon 2 beginning at Chromosome 8 positive strand position 4,249,063 bp, AAGCGGTACATGGTTGTAAC, and ending after GGGGACTGGTCGACCTTGAT, at 4,249,407 bp (GRCm38/mm10). This mutation deletes exon 2 and 208 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change in amino acid sequence after residue 23 and a early truncation after an additional 55 amino acids. |
