| Primary Identifier | MGI:5763667 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Col16a1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Col16a1-7606J-F4542 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGAGCATTAGGAACTCAGGA, AGAATTCCCGGAGCTCTGCT, AGGTCACTATGAACTCTGGG and TCTACCTATTGTCCACCACT, which resulted in a 437 bp deletion spanning exons 3 and 4 beginning at Chromosome 4 positive strand position 130051616 bp, CTCCTGAGTTCCTAATGCTC, and ending after ACTCTACCTATTGTCCACCA, at 130052052 bp (GRCm38/mm10). This mutation deletes exons 3 and 4 and 244 bp of flanking intronic and intron 3-4 sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 24 and early truncation 15 amino acids later. In addition, there is a 5 bp (ctctg) deletion 13 bp before the 437 bp deletion that is not predicted to impact the outcome of this mutation. |
