| Primary Identifier | MGI:5774461 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rab22a |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Rab22a-7696J-M6742 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTAGGCTACAAAGTAGTCTT, TACTTTGTAGCCTAAAGTGG, CGTGGAAAGTCATCGCAAGC and TTCATCAAGTTCAGGACAAC, which resulted in a 218 bp deletion spanning exon 2 beginning at Chromosome 2 positive strand position 173,661,355 bp, CTTTAGGCTACAAAGTAGTC, and ending after GTTCGTGGAAAGTCATCGCA at 173,661,572 bp (GRCm38/mm10). This mutation deletes exon 2 and 138 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 12 and early truncation 12 amino acids later. |
