| Primary Identifier | MGI:5774569 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rasal1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Rasal1-7697J-M1093 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGGCTAGAGTCTCATATGGT, TGGGGGCATGTGTAGACTCT, GAGAATGGGCTGATTCACAG and TGAACCGAATCACATATCAA, which resulted in a 481 bp deletion spanning exons 4-5 beginning at Chromosome 5 positive strand position 120,654,693 bp, TCTAGGAGTGTGTGTGTGAC, and ending after GAGGGAGAATGGGCTGATTC at 120,655,173 bp (GRCm38/mm10). This mutation deletes exons 4 and 5 and 305 bp of flanking intronic sequence including the splice acceptors and donors. This deletion of exons 4 and 5 is predicted to cause a change of amino acid sequence after residue 41 and early truncation 14 amino acids later. |
