| Primary Identifier | MGI:5775609 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ssh1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Ssh1-7708J-M9161 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACTGTTGTACGGTTGAAAAA, TCACCTACTTCCCGGACCTA, GATAAAGGCATCCAGGAAGG and CAGGGGGTGTGTCTCGAACA, which resulted in a 189 bp deletion spanning exon 2 beginning at Chromosome 5 negative strand position 113,989,807 bp, GTCTCGAACACGGCAGCCTC, and ending after CACTTGGCGTTTGTCCTTAG at 113,989,619 bp (GRCm38/mm10). This mutation deletes exon 2 and 148 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to result in early termination after amino acid residue 21. |
