| Primary Identifier | MGI:5775646 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tcerg1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Tcerg1-7710J-M6904 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCAGCTCCAAGGTCACATGG, TATTTTCCCAAGCCTAGAGA, TTAGTATCAATTTTATGCAT and TTATAGAGGTTGCCATTTCT, which resulted in a 343 bp deletion spanning exon 2 beginning at Chromosome 18 positive strand position 42,519,305 bp, CCATGTGACCTTGGAGCTGC, and ending after GTGTTAGTATCAATTTTATG at 42,519,647 bp (GRCm38/mm10). This mutation deletes exon 2 and 117 bp of flanking intronic sequence including the splice acceptor and donor. There is an additional 2 bp deletion 40 bp before the 343 bp deletion and a 6 bp insertion (gtatta) at the 343 bp deletion site, that will not affect the results of the mutation. This deletion is predicted to cause a change of amino acid sequence after residue 20 and early truncation 17 amino acids later. |
