| Primary Identifier | MGI:5775821 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ano7 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Ano7-7738J-M6515 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTTGGCAGTGAGTCATCTGA, GCTCCTTGTCCCTCTGGCCA, GGTGACAGCAGGAAGCCGGT and AGATCGATCACAAGGAGACC, which resulted in a 181 bp deletion spanning exon 3 beginning at Chromosome 1 positive strand position 93,377,228 bp, GAGTCATCTGATGGTTGGAT, and ending after GGGGTGACAGCAGGAAGCC at 93,377,408 bp (GRCm38/mm10). This mutation deletes exon 3 and 123 bp of flanking intronic sequence including the splice acceptor and donor. There is an additional 15 bp deletion of intronic sequence 38 bp 5-prime of the 181 bp deletion, and an 8 bp deletion of intronic sequence 25 bp after the 181 bp deletion, neither of which is expected to alter the overall outcome of the mutation. This deletion is predicted to cause a change of amino acid sequence after residue 36 and early truncation 9 amino acids later. |
