| Primary Identifier | MGI:5776201 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ano8 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Ano8-7739J-F6550 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGCCGGGTGACAGGGCCAGA, TCTCGCACAGTCCTTAGCTT, GGGCCTCCACATTTCCACCG and CCAATGGGTCTTGCCTCGAG, which resulted in a 228 bp deletion in exon 3 beginning at Chromosome 8 negative strand position 71,484,949 bp, TGGAAATGTGGAGGCCCTTGT, and ending after CCTGCCTCTACCTCCCTCT at 71,484,722 bp (GRCm38/mm10). This mutation deletes exon 3 and 95 bp of flanking intronic sequence including the splice acceptor and donor. There is an additional 5 bp deletion 95 bp after the 228 bp deletion that will not affect the mutation. This deletion is predicted to cause a change of amino acid sequence after residue 72 and early truncation 14 amino acids later. |
