|  Help  |  About  |  Contact Us

Allele : Arhgap8<em1(IMPC)J> Rho GTPase activating protein 8; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5776203 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Arhgap8
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Arhgap8-7741J-M2582 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACTCCCTCAATCATAAGCCA, GGGCGTCGCCTACCTCCCCT, CCTGCTCTCCAGGACAGACG and CATGCATCTGCCTCCCCACG, which resulted in a 288 bp deletion in exon 3 beginning at Chromosome 15 positive strand position 84,740,649 bp, GGCTTATGATTGAGGGAGTCC, and ending after GGGGAAACTCCCTCCACCAG at 84,740,936 bp (GRCm38/mm10). This mutation deletes exon 3 and 200 bp of flanking intronic sequence including the splice acceptor and donor. There is an additional 20 bp deletion 59 bp before the 288 bp deletion that will not affect the results of the mutation. The deletion of exon 3 is predicted to cause a change of amino acid sequence after residue 27 and early truncation 1 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Arhgap8<em1J>,
  • Arhgap8<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele