| Primary Identifier | MGI:5776619 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ap2b1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Ap2b1-7740J-M6562 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACAAGGCAGCCACTGAAGTA, TTGCAATATAAAATACCATC, GTAAGGGCTGACTGTCCATA and AAGGGCTGACTGTCCATAGG, which resulted in a 247 bp deletion of exon 3 beginning at Chromosome 11 positive strand position 83,316,316 bp, CTTACTTCAGTGGCTGCCTT, and ending after CCCCCCTATGGACAGTCAGC at 83,316,562 bp (GRCm38/mm10). This mutation deletes exon 3 and 141 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 12 and early truncation 7 amino acids later. |
