|  Help  |  About  |  Contact Us

Allele : Snapc2<em1(IMPC)J> small nuclear RNA activating complex, polypeptide 2; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5784546 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Snapc2
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Snapc2-7778J-F6434 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATCACCTTCAGAGCGTGCAG, GTCCATTCTAGGTCTAGCAG, ATACTGTGTTTGTGTTGCGA and GTTGCGAGGGGGTTGTCTGG, which resulted in a 503 bp deletion around exon 4 beginning at Chromosome 8 positive strand position 4,254,919 bp, GGTCCATTCTAGGTCTAGCA, and ending after TACTGTGTTTGTGTTGCGAG at 4,255,421 bp (GRCm38/mm10). This mutation deletes exon 4 and 121 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 124 and early truncation 27 amino acids later.
  • mutations:
  • Not Specified
  • synonyms:
  • Snapc2<->,
  • Snapc2<->,
  • Snapc2<em1J>,
  • Snapc2<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele