| Primary Identifier | MGI:5784546 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Snapc2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Snapc2-7778J-F6434 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATCACCTTCAGAGCGTGCAG, GTCCATTCTAGGTCTAGCAG, ATACTGTGTTTGTGTTGCGA and GTTGCGAGGGGGTTGTCTGG, which resulted in a 503 bp deletion around exon 4 beginning at Chromosome 8 positive strand position 4,254,919 bp, GGTCCATTCTAGGTCTAGCA, and ending after TACTGTGTTTGTGTTGCGAG at 4,255,421 bp (GRCm38/mm10). This mutation deletes exon 4 and 121 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 124 and early truncation 27 amino acids later. |