| Primary Identifier | MGI:5784550 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Krt90 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Krt90-7840J-M3816 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTCTGGGCCACATAGATGG, TAGAGAACTGCTGAATTCAG, GGACACCCAATAAATAGTAA and CTGAGTTTGGGGGTCATGCA, which resulted in a 327 bp deletion around exon 2 beginning at Chromosome 15 negative strand position 101,560,724 bp, GCAGGGTCCCTTACTATTTA, and ending after AGTGAGTGGGTCCTCCATCT at 101,560,398 bp (GRCm38/mm10). This mutation deletes exon 2 and 118 bp of flanking intronic sequence including the splice acceptor and donor, in addition there is a 4 bp insertion (acag) and a 22 bp deletion (gaattcagcagttctctacatc) 71 bp after the 327 bp deletion that should not alter the results of the 327 bp deletion. This mutation is predicted to cause a change of amino acid sequence after residue 162 and early truncation 11 amino acids later. |
