| Primary Identifier | MGI:5779851 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Wdr45 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Wdr45-7725J-M3004 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGTTGGCAAGACCAAAGTTT, CAAGTGGTTGAGATCCTGTG, GGGCAACTGCCAGCGAGGCG and GAGGTTACCTTACTTGTTGT, which resulted in a 252 bp deletion in exon 5 beginning at Chromosome X positive strand position 7,725,839 bp, GTGGTTGAGATCCTGTGAGG, and ending after GCAGGAAGTTCCCACAACAA at 7,726,090 bp (GRCm38/mm10). This mutation deletes exon 5 and 146 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 5 bp deletion (ctcgc) 46 bp after the 252 bp deletion that will not alter the results of the 252 bp deletion, which is predicted to cause a change of amino acid sequence after residue 78 and early truncation 2 amino acids later. |