|  Help  |  About  |  Contact Us

Allele : Tuba8<em1(IMPC)J> tubulin, alpha 8; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5779854 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Tuba8
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Tuba8-7807J-M772 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TACATCACCCCACAAACAGG, TTCCTCACATCCAATGCACA, GCTCCCCAAGGAGCTAAGAG and TGGCCAAGAGAGCATTCTGC, which resulted in a 480 bp deletion including exon 2 beginning at Chromosome 6 positive strand position 121,220,250 bp, CACCTCCTGTTTGTGGGGTG, and ending after CTCCGTGAGACCTCTCTTAG at 121,220,729 bp (GRCm38/mm10). This mutation deletes exon 2 and 257 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 1 and early truncation 16 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Tuba8<em1J>,
  • Tuba8<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele