| Primary Identifier | MGI:5779854 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tuba8 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Tuba8-7807J-M772 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TACATCACCCCACAAACAGG, TTCCTCACATCCAATGCACA, GCTCCCCAAGGAGCTAAGAG and TGGCCAAGAGAGCATTCTGC, which resulted in a 480 bp deletion including exon 2 beginning at Chromosome 6 positive strand position 121,220,250 bp, CACCTCCTGTTTGTGGGGTG, and ending after CTCCGTGAGACCTCTCTTAG at 121,220,729 bp (GRCm38/mm10). This mutation deletes exon 2 and 257 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 1 and early truncation 16 amino acids later. |
