| Primary Identifier | MGI:5779860 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | C1qc |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project C1qc-7743J-M6896 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGGTGTTCGTGCCGAGTGAA, ACTCGCACACTAGCTGCTAC, GACATGATAGGGCAGAAGGC and AGATAGCTCTGCCCAGGTGG, which resulted in a 989 bp deletion in exon 3 beginning at Chromosome 4 negative strand position 136,890,711 bp, CCTGGGCAGAGCTATCTGGA, and ending after GGGTGTTCGTGCCGAGTGAA at 136,889,723 bp (GRCm38/mm10). This mutation deletes exon 3 and 193 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a single bp insertion (A) and 5 bp deletion (ggagc) 89 bp after the 989 bp deletion that are not predicted alter the results of the mutation. If read through after exon 2 occurs, a change of amino acid sequence after residue 62 and early truncation 28 amino acids later is predicted. |
