| Primary Identifier | MGI:5779710 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Lgals4 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Lgals4-7682J-F3313 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACTCTCAGTCCCTTAAGCGG, GACCAGGTGAAGAGCCTCAG, GCACTTCCCCGCTCACCCCA and TCCCTAACTCTGATGCCAGG, which resulted in a 278 bp deletion in exon 2 beginning at Chromosome 7 positive strand position 28,834,332 bp, CTCCTTACCCTAAGTCTCAT, and ending after TTCCCTAACTCTGATGCCAG at 28,834,609 bp (GRCm38/mm10). This mutation deletes exon 2 and 189 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 15 and early truncation 10 amino acids later. |
