|  Help  |  About  |  Contact Us

Allele : Tmem9b<em1(IMPC)J> TMEM9 domain family, member B; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5784648 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Tmem9b
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Tmem9b-7805J-M0788 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATCACCTGCTACATAAACCG, AAACAGAAAGCTCTAGGCCG, ATGGTTTTAGAATATCTGAC and TGGTTTTAGAATATCTGACA, which resulted in a 236 bp deletion around exon 2 beginning at Chromosome 7 negative strand position 109,750,210 bp, TTAGAATATCTGACAGGGAT, and ending after GGTATCACCTGCTACATAAA at 109,749,975 bp (GRCm38/mm10). This mutation deletes exon 2 and 144 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 28 bp insertion (gctcagtcccatctgaaatgaaacctcc) at this site as and a 4 bp deletion 140 bp after the 236 bp deletion, neither of which is expected to alter the result of the 236 bp deletion, which is predicted to cause early truncation after 36 amino acids.
  • mutations:
  • Not Specified
  • synonyms:
  • Tmem9b<em1J>,
  • Tmem9b<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele