|  Help  |  About  |  Contact Us

Allele : Drc7<em1(IMPC)J> dynein regulatory complex subunit 7; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5784926 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Drc7
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Drc7-7877J-F7837 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCTGACTTCTTGCTCTTCCG, GCAAGTCTGGGTCTGGGGTA, GCTCAGCAGAGGAGCCGTAG and GCTCTGAGTACAGAGCTGGC, which resulted in a 292 bp deletion around exon 9 beginning at Chromosome 8 positive strand position 95,070,286 bp, CTCTTCCGGGGAAACTGACA, and ending after TCAACACCCTGCCAGCTCTG at 95,070,577 bp (GRCm38/mm10). This mutation deletes exon 9 and 219 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 404 and early truncation 11 amino acids later.
  • mutations:
  • Not Specified
  • synonyms:
  • Drc7<em1J>,
  • Drc7<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele