| Primary Identifier | MGI:5787575 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zfp612 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Zfp612-7727J-M3059 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGCTCAGGCCCTAAGTAAAG, GAGCACAAAGTTAGTAACAA, GCGCCTTTCTTCCTAAGAAG and GTTTGGTAATTCTTTATGAG, which resulted in a 365 bp deletion around exon 3 beginning at Chromosome 8 positive strand position 110,083,490 bp, ATCCCATAGTTTACTTCCCC, and ending after CTTTCTTCCTAAGAAGTGGT at 110,083,854 bp (GRCm38/mm10). This mutation deletes exon 3 and 238 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 62 bp insertion at the same site, which was inserted from 824 bp upstream of the deletion, as well as a 20 bp deletion (tttggtaattctttatgagt) and 2 bp insertion (AG) 9 bp after the 365 bp deletion that will not alter the result of the exon deletion. This 365 bp deletion is predicted to cause a change of amino acid sequence after residue 8 and early truncation 8 amino acids later. |
