|  Help  |  About  |  Contact Us

Allele : Nrap<em1(IMPC)J> nebulin-related anchoring protein; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5788510 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Nrap
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Nrap-7921J-M3386 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACCTCGGGAGAGGTGCTACT, GCTCGCCACTGCATGACTTT, CCTGGAGGAGGACAGCTAAT and AGACTTTCAGGTTAAAAAGT, which resulted in a 248 bp deletion beginning at Chromosome 19 negative strand position 56,389,523 bp GAGGACAGCTAATTGGCAGA, and ending after CGAGTAGCACCTCTCCCGAG at 56,389,276 bp (GRCm38/mm10). This mutation deletes exon 2 and 153 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 24 and early truncation 3 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Nrap<em1J>,
  • Nrap<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele