| Primary Identifier | MGI:5788340 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Fam114a1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Fam114a1-7878J-M7854 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACCAAGCAACCACATCTCCC, AGATGTGGTTGCTTGGTGGT, TTTGACATAGCGTACATTGA and ATGGAGTTTAACGTTTGCTC, which resulted in a 314 bp deletion beginning at Chromosome 5 positive strand position 64,995,684 bp, GGGAGATGTGGTTGCTTGGT, and ending after GGAGTTTAACGTTTGCTCAG at 64,995,997 bp (GRCm38/mm10). This mutation deletes exon 3 and 226 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 116 and early truncation 3 amino acids later. |