|  Help  |  About  |  Contact Us

Allele : Dlat<em1(IMPC)J> dihydrolipoamide S-acetyltransferase; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5788343 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Dlat
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Dlat-7876J-M7804 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTTTTTATAAAATATGACCC, CAGCTCAGAACTGACACGTG, GACCTTGTCACCCATCACAA and CTGAATGCTTTTATGCGTCC, which resulted in a 325 bp deletion beginning at Chromosome 9 negative strand position 50,653,854 bp, TTGTGATGGGTGACAAGGTC, and ending after TTGCTGCCTGGGTCATATTT at 50,653,530 bp (GRCm38/mm10). This mutation deletes exon 5 and 198 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 7 bp (cgtgtca) intronic deletion 24 bp after the 325 bp deletion that will not alter the result of the mutation. The 325 bp deletion is predicted to cause a change of amino acid sequence after residue 219 and early truncation 30 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Dlat<em1J>,
  • Dlat<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele