| Primary Identifier | MGI:5788415 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Foxk2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Foxk2-7879J-M7860 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AATACCATGCTTCCTTTAAA, TTTCCTGACCCAGCTCGTTA, TTTATAGTCGTGGATTTGGG and GATACTGGTAACTAGTCCTT, which resulted in a 324 bp deletion beginning at Chromosome 11 positive strand position 121,287,817 bp GGCAAACCACATAATAAATA, and ending after ATACTGGTAACTAGTCCTTT at 121,288,140 bp (GRCm38/mm10). This mutation deletes exon 3 and 176 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 195 and early truncation 12 amino acids later. |
