| Primary Identifier | MGI:5788754 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ccdc146 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Ccdc146-7865J-F7713 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGGGGCAAAGATCAGAGTTC, AGGTTGTGAATGTGTGAAGA, AGTAACCTATGTGCATCCAC and GATCACTGTTCGTATGCCTG, which resulted in a 297 bp deletion beginning at Chromosome 5 negative strand position 21,333,199 bp CACAGGCATATGGACAGTGA, and ending after TGGGGCAAAGATCAGAGTTC at 21,332,903 bp (GRCm38/mm10). This mutation deletes exon 3 and 214 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single bp (G) deleted 40 bp before the 297 bp deletion that will not have any effect on the exon deletion that is predicted to cause a change of amino acid sequence after residue 74 and early truncation 4 amino acids later. |
