|  Help  |  About  |  Contact Us

Allele : Nars2<em1(IMPC)J> asparaginyl-tRNA synthetase 2 (mitochondrial)(putative); endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5790096 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Nars2
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Nars2-7918J-F3847 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTCTGGCTGACATAAGAGAA, ATTCAGAAAAAGACTGCTAG, GTGAAAATGTTAGACCTTAA and GAACTCTTTAGAAAAGAAAG, which resulted in a 365 bp deletion beginning at Chromosome 7 positive strand position 96,955,866 bp CTAGCAGTCTTTTTCTGAAT, and ending after GAACCAGGAGCCCTTAAGGT at 96,956,230 bp (GRCm38/mm10). This mutation deletes exon 2 and 255 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 47 and early truncation 31 amino acids later. There is a single bp (G) insertion 53 bp before the 365 bp deletion that will not alter the results of the deletion.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Nars2<em1J>,
  • Nars2<->,
  • Nars2<em1J>,
  • Nars2<->
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

6 Publication categories

Trail: Allele