| Primary Identifier | MGI:5790097 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Nim1k |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Nim1k-7775J-M6390 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGCTTTGGAGGCATGGACCA, GCCATGGGAACCGGGAACGT, TGATGATGATGTGTTATAAT and CTTTATTCTATTAGACATAG, which resulted in a 603 bp deletion beginning at Chromosome 13 negative strand position 119,714,667 bp GTTCTGACCAGGAGTGCTCT, and ending after CCTGCCATGGGAACCGGGAAC at 119,714,065 bp (GRCm38/mm10). This mutation deletes exon 3 and 334 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 97 and early truncation 1 amino acid later. In addition there is a 7 bp deletion (tccatgc) 96 bp after the 603 bp deletion that will not alter the results of the exon deletion. |
