| Primary Identifier | MGI:5790099 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tbc1d30 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Tbc1d30-7955J-M6512 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTGTGTATGTTCTCTGGAAA, ATTGCGTTCCCAGAAGTGTT, TTGGTTTCTGACGCATCAGG and TGGGCATATTAAAATCCTGG, which resulted in a 349 bp deletion beginning at Chromosome 10 negative strand position 121,297,003bp CATCAGGAGGAACTTTGGTC, and ending after CTATTGCGTTCCCAGAAGTG at 121,296,655bp (GRCm38/mm10). This mutation deletes exon 6 and 180 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 199 and early truncation 29 amino acids later. |
