| Primary Identifier | MGI:5790100 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Slc25a46 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Slc25a46-7953J-M6621 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AATCTGTTAATAAAACCTAA, TCACTTTGAGGTTTATGCAG, TCAAATTCTGATATGGAACA and GTTTAAATAGTGAATGACTC, which resulted in a 365 bp deletion beginning at Chromosome 18 negative strand position 31,607,404 bp CAGAGTCATTCACTATTTAA, and ending after AGTCATTCCACTGCATAAAC at 31,607,040 bp (GRCm38/mm10). This mutation deletes exon 2 and 322 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 94 and early truncation 70 amino acids later. |
