| Primary Identifier | MGI:5790203 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Osbpl10 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Osbpl10-7566J-F3946 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACCACGCCATGTGTGCCCCG, TATCCAACCTAGTCATGTGA, GCAGCTGCCAGATAGGACAG and CTGCTACGTGCTTTAAGAGG, which resulted in a 403 bp deletion beginning at Chromosome 9 positive strand position 115,175,848 bp CATGACTAGGTTGGATATTT, and ending after CCTGCCTGGAACTCACCCCTG at 115,176,250 bp (GRCm38/mm10). This mutation deletes exon 4 and 248 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 140 and early truncation 5 amino acids later. |
