| Primary Identifier | MGI:5790204 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rab11b |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Rab11b-7933J-M7053 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTAGGGGCTGAACTAGAGCA, GTAGGGGCTGAACTAGAGCA, TTACCAGTGTGTCCCAGCGT and CACCCAGCAAACCTGCATGG, which resulted in a 549 bp deletion beginning at Chromosome 17 negative strand position 33,750,102 bp CCAGCGTGGGAAAATCCGTG, and ending after TTCCATTTTCACCCAACCTC at 33,749,554 bp (GRCm38/mm10). This mutation deletes exon 2 and 353 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 13 and early truncation 18 amino acids later. |
