| Primary Identifier | MGI:5792573 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rprd1a |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Rprd1a-7936J-F7112 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGAGTTATGTGGCTGATGAG, AGCGTTCATACAGTGTGTGA, CGCTGCTACTAACATCTCCA and GATGAGTGTGTTCGGAGAAG, which resulted in a 333 bp deletion beginning at Chromosome 18 negative strand position 24,510,041 bp, TAGCAGCGACGTGATGAGTG, and ending after TAAAGCGTTCATACAGTGTG at 24,509,709 bp (GRCm38/mm10). This mutation deletes exon 2 and 203 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single bp insertion (A) at the site of the deletion and another insertion (T) 37 bp before the 333 bp deletion that will not alter the result of the mutation. This 333 bp deletion is predicted to cause a change of amino acid sequence after residue 50 and early truncation 28 amino acids later. |