| Primary Identifier | MGI:5795835 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Saraf |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Saraf-7950J- F6680 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CGTCAGAGACTAGGTCTACT, CTTCTTAGACTGCTGGCGGG, GTTAACCTCCTCTTCAAACC and ACCCATGGACCCGCTGAGCA, which resulted in a 501 bp deletion beginning at Chromosome 8 positive strand position 34,165,102 bp TAGACCTAGTCTCTGACGTT, and ending after GGCCAGTCACGTGCCTGGTT at 34,165,602 bp (GRCm38/mm10). This mutation deletes exon 3 and 101 bp of flanking intronic sequence including the splice acceptor and donor, in addition there is a 4 bp deletion (CCGC) 26 bp before the 501 bp deletion which will not alter the results of the mutation. This exon deletion is predicted to cause a change of amino acid sequence after residue 125 and early truncation 109 amino acids later. |
